Stem-loop sequence hsa-mir-4762

Accession MI0017403
Description Homo sapiens miR-4762 stem-loop
Stem-loop 
-c       c                     gaucag 
  ugauacc caaaucuugaucagaagccuu      a
  ||||||| |||||||||||||||||||||       
  acugugg guuuagaacuagucuucggaa      a
ga       u                     ggaucg
Get sequence
Deep sequencing
4 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr22: 46156404-46156478 [+]
sense
OTTHUMT00000322283 ; ATXN10-007; intron 2
OTTHUMT00000322283 ; ATXN10-007; intron 2
OTTHUMT00000322283 ; ATXN10-007; intron 2
OTTHUMT00000322286 ; ATXN10-010; intron 3
OTTHUMT00000322282 ; ATXN10-006; intron 3
OTTHUMT00000322286 ; ATXN10-010; intron 3
OTTHUMT00000322282 ; ATXN10-006; intron 3
OTTHUMT00000322286 ; ATXN10-010; intron 3
OTTHUMT00000322282 ; ATXN10-006; intron 3
OTTHUMT00000318142 ; ATXN10-001; intron 9
OTTHUMT00000318142 ; ATXN10-001; intron 9
OTTHUMT00000318142 ; ATXN10-001; intron 9
ENST00000451241 ; ATXN10-007; intron 2
ENST00000451241 ; ATXN10-007; intron 2
ENST00000451241 ; ATXN10-007; intron 2
ENST00000435026 ; ATXN10-010; intron 3
ENST00000493643 ; ATXN10-006; intron 3
ENST00000435026 ; ATXN10-010; intron 3
ENST00000493643 ; ATXN10-006; intron 3
ENST00000435026 ; ATXN10-010; intron 3
ENST00000493643 ; ATXN10-006; intron 3
ENST00000381061 ; ATXN10-201; intron 8
ENST00000381061 ; ATXN10-201; intron 8
ENST00000381061 ; ATXN10-201; intron 8
ENST00000252934 ; ATXN10-001; intron 9
ENST00000252934 ; ATXN10-001; intron 9
ENST00000252934 ; ATXN10-001; intron 9
ENST00000396011 ; ATXN10-202; intron 10
ENST00000396011 ; ATXN10-202; intron 10
Database links

Mature sequence hsa-miR-4762-5p

Accession MIMAT0019910
Sequence

9 -  

ccaaaucuugaucagaagccu

 - 29

Get sequence
Deep sequencing 4 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4762-3p

Accession MIMAT0019911
Sequence

49 -  

cuucugaucaagauuuguggug

 - 70

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).