Stem-loop sequence hsa-mir-4760

Accession MI0017401
Description Homo sapiens miR-4760 stem-loop
Stem-loop 
       u                  g    aauucuua 
gccaugg guuuagauugaacaugaa uuag        a
||||||| |||||||||||||||||| ||||         
cgguacc caaaucuaacuuguacuu aauc        g
       c                  a    aaaacuau
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr21: 41584279-41584358 [-]
sense
OTTHUMT00000325302 ; TMPRSS3-009; intron 6
OTTHUMT00000325302 ; TMPRSS3-009; intron 6
OTTHUMT00000195030 ; DSCAM-002; intron 7
OTTHUMT00000195030 ; DSCAM-002; intron 7
OTTHUMT00000195030 ; DSCAM-002; intron 7
OTTHUMT00000195029 ; DSCAM-001; intron 11
OTTHUMT00000195029 ; DSCAM-001; intron 11
OTTHUMT00000195029 ; DSCAM-001; intron 11
ENST00000553129 ; TMPRSS3-009; intron 6
ENST00000553129 ; TMPRSS3-009; intron 6
ENST00000404019 ; DSCAM-002; intron 7
ENST00000404019 ; DSCAM-002; intron 7
ENST00000404019 ; DSCAM-002; intron 7
ENST00000400454 ; DSCAM-001; intron 11
ENST00000400454 ; DSCAM-001; intron 11
ENST00000400454 ; DSCAM-001; intron 11
Database links

Mature sequence hsa-miR-4760-5p

Accession MIMAT0019906
Sequence

10 -  

uuuagauugaacaugaaguuag

 - 31

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4760-3p

Accession MIMAT0019907
Sequence

52 -  

aaauucauguucaaucuaaacc

 - 73

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).