Stem-loop sequence hsa-mir-4756

Accession

MI0017397

Description

Homo sapiens miR-4756 stem-loop

Stem-loop

  g        c         cu  c      c   cg 
gg auaaaaug agggaggcg  ca ucucug ugc  a
|| |||||||| |||||||||  || |||||| |||  u
cu uguuuuau uccuuccgu  gu agagac acg  u
  g        a         ug  -      c   uc 

Genome context

• Coordinates (GRCh37.p5): chr20: 52684947-52685024 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000079766 ; BCAS1-001; intron 1

  OTTHUMT00000259203 ; BCAS1-003; intron 1

  OTTHUMT00000079766 ; BCAS1-001; intron 1

  OTTHUMT00000259203 ; BCAS1-003; intron 1

  OTTHUMT00000079766 ; BCAS1-001; intron 1

  OTTHUMT00000259203 ; BCAS1-003; intron 1

  ENST00000395961 ; BCAS1-001; intron 1

  ENST00000371435 ; BCAS1-003; intron 1

  ENST00000371440 ; BCAS1-201; intron 1

  ENST00000411563 ; BCAS1-202; intron 1

  ENST00000395961 ; BCAS1-001; intron 1

  ENST00000371435 ; BCAS1-003; intron 1

  ENST00000371440 ; BCAS1-201; intron 1

  ENST00000411563 ; BCAS1-202; intron 1

  ENST00000395961 ; BCAS1-001; intron 1

  ENST00000371435 ; BCAS1-003; intron 1

  ENST00000371440 ; BCAS1-201; intron 1

  ENST00000411563 ; BCAS1-202; intron 1

Database links

• ENTREZGENE: 100616225;MIR4756

Mature sequence hsa-miR-4756-5p

• Accession: MIMAT0019899
• Sequence: 12 - cagggaggcgcucacucucugcu - 34
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4756-5p
  • MIRDB:hsa-miR-4756-5p
  • TARGETMINER:hsa-miR-4756-5p

Mature sequence hsa-miR-4756-3p

• Accession: MIMAT0019900
• Sequence: 47 - ccagagaugguugccuuccuau - 68
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4756-3p
  • MIRDB:hsa-miR-4756-3p
  • TARGETMINER:hsa-miR-4756-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).