Stem-loop sequence hsa-mir-499b

AccessionMI0017396 (change log)
Previous IDshsa-mir-499a
Symbol HGNC:MIR499B
DescriptionHomo sapiens miR-499b stem-loop
Stem-loop
   ggaa  a  ---ac        u        -c  gugg 
5'     gc gc     agacuugc gugauguu  ac    a
       || ||     |||||||| ||||||||  ||     
3'     cg cg     ucugaacg cacuacaa  ug    g
   ---c  c  acaau        u        au  agga 
Get sequence
Deep sequencing
395 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 34990400-34990472 [-]
antisense
OTTHUMT00000079023 ; DLGAP4-005; intron 1
ENST00000373913 ; DLGAP4-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-499b
hsa-mir-499bchr20: 34990400-34990472 [-]
hsa-mir-499achr20: 34990376-34990497 [+]
Database links

Mature sequence hsa-miR-499b-5p

Accession MIMAT0019897
Previous IDshsa-miR-499a-5p
Sequence

10 - 

acagacuugcugugauguuca

 - 30

Get sequence
Deep sequencing73 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-499b-3p

Accession MIMAT0019898
Previous IDshsa-miR-499a-3p
Sequence

46 - 

aacaucacugcaagucuuaaca

 - 67

Get sequence
Deep sequencing322 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).