Stem-loop sequence hsa-mir-499b

Accession MI0017396
Previous IDs hsa-mir-499a
Description Homo sapiens miR-499b stem-loop
Stem-loop 
ggaa  a  ---ac        u        -c  gugg 
    gc gc     agacuugc gugauguu  ac    a
    || ||     |||||||| ||||||||  ||     
    cg cg     ucugaacg cacuacaa  ug    g
---c  c  acaau        u        au  agga
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 33578203-33578275 [-]
antisense
OTTHUMT00000078833 ; MYH7B-001; intron 20
OTTHUMT00000078833 ; MYH7B-001; intron 20
OTTHUMT00000078833 ; MYH7B-001; intron 20
ENST00000384903 ; MIR499-201; exon 1
ENST00000384903 ; MIR499A-201; exon 1
ENST00000384903 ; MIR499A-201; exon 1
ENST00000262873 ; MYH7B-001; intron 20
ENST00000262873 ; MYH7B-001; intron 20
ENST00000262873 ; MYH7B-001; intron 20
Clustered miRNAs
< 10kb from hsa-mir-499b
hsa-mir-499b chr20: 33578203-33578275 [-]
hsa-mir-499a chr20: 33578179-33578300 [+]
Database links

Mature sequence hsa-miR-499b-5p

Accession MIMAT0019897
Previous IDs hsa-miR-499a-5p
Sequence

10 -  

acagacuugcugugauguuca

 - 30

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-499b-3p

Accession MIMAT0019898
Previous IDs hsa-miR-499a-3p
Sequence

46 -  

aacaucacugcaagucuuaaca

 - 67

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).