Stem-loop sequence hsa-mir-4755

Accession MI0017395
Description Homo sapiens miR-4755 stem-loop
Stem-loop 
                               g ca 
agauucagcuuucccuucagagccuggcuuu g  u
||||||||||||||||||||||||||||||| |   
ucuaaguugaaagggaagucucggaccgaaa u  c
                               g au
Get sequence
Deep sequencing
4 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 32636925-32636996 [+]
sense
OTTHUMT00000078752 ; RALY-001; intron 2
OTTHUMT00000078753 ; RALY-002; intron 2
OTTHUMT00000078755 ; RALY-004; intron 2
OTTHUMT00000078756 ; RALY-005; intron 2
OTTHUMT00000078758 ; RALY-007; intron 2
OTTHUMT00000078752 ; RALY-001; intron 2
OTTHUMT00000078753 ; RALY-002; intron 2
OTTHUMT00000078755 ; RALY-004; intron 2
OTTHUMT00000078756 ; RALY-005; intron 2
OTTHUMT00000078758 ; RALY-007; intron 2
OTTHUMT00000078752 ; RALY-001; intron 2
OTTHUMT00000078753 ; RALY-002; intron 2
OTTHUMT00000078755 ; RALY-004; intron 2
OTTHUMT00000078756 ; RALY-005; intron 2
OTTHUMT00000078758 ; RALY-007; intron 2
OTTHUMT00000078754 ; RALY-003; intron 3
OTTHUMT00000078754 ; RALY-003; intron 3
OTTHUMT00000078754 ; RALY-003; intron 3
ENST00000375114 ; RALY-001; intron 2
ENST00000448364 ; RALY-004; intron 2
ENST00000246194 ; RALY-002; intron 2
ENST00000333552 ; RALY-005; intron 2
ENST00000442805 ; RALY-007; intron 2
ENST00000375114 ; RALY-001; intron 2
ENST00000448364 ; RALY-004; intron 2
ENST00000246194 ; RALY-002; intron 2
ENST00000333552 ; RALY-005; intron 2
ENST00000442805 ; RALY-007; intron 2
ENST00000375114 ; RALY-001; intron 2
ENST00000448364 ; RALY-004; intron 2
ENST00000246194 ; RALY-002; intron 2
ENST00000333552 ; RALY-005; intron 2
ENST00000442805 ; RALY-007; intron 2
ENST00000413297 ; RALY-003; intron 3
ENST00000413297 ; RALY-003; intron 3
ENST00000413297 ; RALY-003; intron 3
Database links

Mature sequence hsa-miR-4755-5p

Accession MIMAT0019895
Sequence

10 -  

uuucccuucagagccuggcuuu

 - 31

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4755-3p

Accession MIMAT0019896
Sequence

44 -  

agccaggcucugaagggaaagu

 - 65

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).