Stem-loop sequence hsa-mir-4753

Accession

MI0017392

Description

Homo sapiens miR-4753 stem-loop

Stem-loop

               c               auauau   c  u 
auaucuacacaaggc aaaggaagagaacag      cca ag a
||||||||||||||| |||||||||||||||      ||| ||  
uauagauguguuccg uuucuuucucuuguc      ggu uc c
               a               ------   -  a 

Deep sequencing

7 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 235353349-235353431 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000095554 ; ARID4B-012; intron 1

  OTTHUMT00000095554 ; ARID4B-012; intron 1

  OTTHUMT00000095554 ; ARID4B-012; intron 1

  OTTHUMT00000095568 ; ARID4B-006; intron 3

  OTTHUMT00000095568 ; ARID4B-006; intron 3

  OTTHUMT00000095568 ; ARID4B-006; intron 3

  OTTHUMT00000095565 ; ARID4B-003; intron 11

  OTTHUMT00000095565 ; ARID4B-003; intron 11

  OTTHUMT00000095565 ; ARID4B-003; intron 11

  OTTHUMT00000095563 ; ARID4B-001; intron 18

  OTTHUMT00000095567 ; ARID4B-005; intron 18

  OTTHUMT00000095563 ; ARID4B-001; intron 18

  OTTHUMT00000095567 ; ARID4B-005; intron 18

  OTTHUMT00000095563 ; ARID4B-001; intron 18

  OTTHUMT00000095567 ; ARID4B-005; intron 18

  OTTHUMT00000095566 ; ARID4B-004; intron 19

  OTTHUMT00000318406 ; ARID4B-010; intron 19

  OTTHUMT00000095566 ; ARID4B-004; intron 19

  OTTHUMT00000318406 ; ARID4B-010; intron 19

  OTTHUMT00000095566 ; ARID4B-004; intron 19

  OTTHUMT00000318406 ; ARID4B-010; intron 19

  ENST00000474953 ; ARID4B-012; intron 1

  ENST00000474953 ; ARID4B-012; intron 1

  ENST00000474953 ; ARID4B-012; intron 1

  ENST00000444620 ; ARID4B-006; intron 3

  ENST00000444620 ; ARID4B-006; intron 3

  ENST00000444620 ; ARID4B-006; intron 3

  ENST00000471257 ; ARID4B-003; intron 11

  ENST00000471257 ; ARID4B-003; intron 11

  ENST00000471257 ; ARID4B-003; intron 11

  ENST00000349213 ; ARID4B-001; intron 18

  ENST00000491632 ; ARID4B-005; intron 18

  ENST00000439834 ; ARID4B-203; intron 18

  ENST00000349213 ; ARID4B-001; intron 18

  ENST00000491632 ; ARID4B-005; intron 18

  ENST00000439834 ; ARID4B-203; intron 18

  ENST00000349213 ; ARID4B-001; intron 18

  ENST00000491632 ; ARID4B-005; intron 18

  ENST00000366603 ; ARID4B-004; intron 19

  ENST00000421364 ; ARID4B-010; intron 19

  ENST00000391856 ; ARID4B-202; intron 19

  ENST00000264183 ; ARID4B-201; intron 19

  ENST00000366603 ; ARID4B-004; intron 19

  ENST00000421364 ; ARID4B-010; intron 19

  ENST00000391856 ; ARID4B-202; intron 19

  ENST00000264183 ; ARID4B-201; intron 19

  ENST00000366603 ; ARID4B-004; intron 19

  ENST00000421364 ; ARID4B-010; intron 19

  ENST00000264183 ; ARID4B-201; intron 19

Database links

• ENTREZGENE: 100616224;MIR4753

Mature sequence hsa-miR-4753-5p

• Accession: MIMAT0019890
• Sequence: 10 - caaggccaaaggaagagaacag - 31
• Deep sequencing: 7 reads, 5 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4753-5p
  • MIRDB:hsa-miR-4753-5p
  • TARGETMINER:hsa-miR-4753-5p

Mature sequence hsa-miR-4753-3p

• Accession: MIMAT0019891
• Sequence: 56 - uucucuuucuuuagccuugugu - 77
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4753-3p
  • MIRDB:hsa-miR-4753-3p
  • TARGETMINER:hsa-miR-4753-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).