Stem-loop sequence hsa-mir-4751

Accession MI0017390
Description Homo sapiens miR-4751 stem-loop
Stem-loop 
-c       ca       cgu    g       -g   g 
  ccggagc  gaggacc   agcu cuagaag  gca g
  |||||||  |||||||   |||| |||||||  |||  
  ggucucg  cuucugg   ucgg ggucuuc  ugu g
gc       -a       ---    g       gg   g
Get sequence
Deep sequencing
2 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 50436321-50436394 [+]
sense
ENST00000423777 ; ATF5-201; exon 4
ENST00000423777 ; ATF5-201; exon 4
ENST00000423777 ; ATF5-201; exon 4
antisense
OTTHUMT00000347385 ; SIGLEC11-004; intron 2
OTTHUMT00000347385 ; SIGLEC11-004; intron 2
OTTHUMT00000347385 ; SIGLEC11-004; intron 2
ENST00000451973 ; SIGLEC11-004; intron 2
ENST00000451973 ; SIGLEC11-004; intron 2
ENST00000451973 ; SIGLEC11-004; intron 2
Database links

Mature sequence hsa-miR-4751

Accession MIMAT0019888
Sequence

10 -  

agaggacccguagcugcuagaagg

 - 33

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).