Stem-loop sequence hsa-mir-4750

Accession MI0017389
Description Homo sapiens miR-4750 stem-loop
Stem-loop 
cg  -    c  a     -  ga     g 
  cu cggg gg ggugg uu  gugcc a
  || |||| || ||||| ||  |||||  
  ga gccc cc ccacc ag  cgcgg c
--  c    u  c     c  uc     u
Get sequence
Deep sequencing
16 reads, 8 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 50391432-50391487 [+]
sense
ENST00000535102 ; TBC1D17-202; intron 14
ENST00000535102 ; TBC1D17-202; intron 14
ENST00000535102 ; TBC1D17-202; intron 14
ENST00000221543 ; TBC1D17-201; intron 15
ENST00000221543 ; TBC1D17-201; intron 15
ENST00000221543 ; TBC1D17-201; intron 15
Database links

Mature sequence hsa-miR-4750-5p

Accession MIMAT0019887
Previous IDs hsa-miR-4750
Sequence

3 -  

cucgggcggaggugguugagug

 - 24

Get sequence
Deep sequencing 16 reads, 8 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4750-3p

Accession MIMAT0022979
Sequence

35 -  

ccugacccacccccucccgcag

 - 56

Get sequence
Evidence not experimental

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).