Stem-loop sequence hsa-mir-4745

Accession MI0017384
Description Homo sapiens miR-4745 stem-loop
Stem-loop 
--guga       -  -     a   c   cg 
      guggggc uc ccggg cgg gcc  c
      ||||||| || ||||| ||| |||   
      cacucug ag ggccc guc cgg  c
cccugg       c  c     g   c   uc
Get sequence
Deep sequencing
57 reads, 11 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 804940-805001 [+]
sense
ENST00000350092 ; PTBP1-202; intron 2
ENST00000350092 ; PTBP1-202; intron 2
ENST00000350092 ; PTBP1-202; intron 2
ENST00000356948 ; PTBP1-203; intron 7
ENST00000394601 ; PTBP1-204; intron 7
ENST00000349038 ; PTBP1-201; intron 7
ENST00000356948 ; PTBP1-203; intron 7
ENST00000394601 ; PTBP1-204; intron 7
ENST00000349038 ; PTBP1-201; intron 7
ENST00000356948 ; PTBP1-203; intron 7
ENST00000394601 ; PTBP1-204; intron 7
ENST00000349038 ; PTBP1-201; intron 7
Clustered miRNAs
< 10kb from hsa-mir-4745
hsa-mir-4745 chr19: 804940-805001 [+]
hsa-mir-3187 chr19: 813584-813653 [+]
Database links

Mature sequence hsa-miR-4745-5p

Accession MIMAT0019878
Sequence

2 -  

ugaguggggcucccgggacggcg

 - 24

Get sequence
Deep sequencing 48 reads, 8 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4745-3p

Accession MIMAT0019879
Sequence

38 -  

uggcccggcgacgucucacgguc

 - 60

Get sequence
Deep sequencing 5 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).