Stem-loop sequence hsa-mir-3591

Accession MI0017383
Description Homo sapiens miR-3591 stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    auuu             c     auagu 
cag agcu    agugugauaaugg guuug     u
||| ||||    ||||||||||||| |||||      
guc ucga    ucacacuguuacc caaac     u
   -    cacc             a     acaga 
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 56118312-56118384 [-]
antisense
ENST00000385044 ; MIR122-201; exon 1
ENST00000385044 ; MIR122-201; exon 1
ENST00000385044 ; MIR122-201; exon 1
Clustered miRNAs
< 10kb from hsa-mir-3591
hsa-mir-3591 chr18: 56118312-56118384 [-]
hsa-mir-122 chr18: 56118306-56118390 [+]
Database links

Mature sequence hsa-miR-3591-5p

Accession MIMAT0019876
Sequence

10 - 

uuuagugugauaauggcguuuga

 - 32

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-3591-3p

Accession MIMAT0019877
Sequence

45 - 

aaacaccauugucacacuccac

 - 66

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).