Stem-loop sequence hsa-mir-4743

Accession MI0017381
Description Homo sapiens miR-4743 stem-loop
Gene family MIPF0001384; mir-4743
Stem-loop 
g    -     ug        -     --   u  g 
 cugg ccgga  ggacagga ggcau  gaa ga c
 |||| |||||  |||||||| |||||  ||| ||  
 gacc ggucu  ucugucuu ccgua  cuu cu c
-    u     uu        u     ac   u  a
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 46196971-46197039 [+]
sense
OTTHUMT00000255907 ; KIAA0427-001; intron 5
OTTHUMT00000255907 ; KIAA0427-001; intron 5
OTTHUMT00000255907 ; KIAA0427-001; intron 5
ENST00000420275 ; CTIF-202; intron 4
ENST00000420275 ; CTIF-202; intron 4
ENST00000256413 ; CTIF-001; intron 5
ENST00000256413 ; CTIF-001; intron 5
ENST00000256413 ; CTIF-001; intron 5
ENST00000382998 ; CTIF-201; intron 6
ENST00000382998 ; CTIF-201; intron 6
ENST00000382998 ; CTIF-201; intron 6
Database links

Mature sequence hsa-miR-4743-5p

Accession MIMAT0019874
Previous IDs hsa-miR-4743
Sequence

3 -  

uggccggaugggacaggaggcau

 - 25

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-4743-3p

Accession MIMAT0022978
Sequence

49 -  

uuucugucuuuucugguccag

 - 69

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [2]

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).