Stem-loop sequence hsa-mir-4741

Accession

MI0017379

Description

Homo sapiens miR-4741 stem-loop

Stem-loop

   gcg   cg  u      g      ---     ---------      ca 
cgg   ggg  gg ccggcc ccuccg   agccc         ggccgg  g
|||   |||  || |||||| ||||||   |||||         ||||||   
gcc   ccc  uc ggcugg ggaggc   ucggg         ccggcc  c
   --a   uu  -      -      cug     cgcgaaauu      cc 

Deep sequencing

218 reads, 19 experiments

Genome context

• Coordinates (GRCh37.p5): chr18: 20513312-20513401 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000254699 ; RBBP8-001; 3'UTR (exon 1)

  OTTHUMT00000254699 ; RBBP8-001; 3'UTR (exon 1)

  OTTHUMT00000254699 ; RBBP8-001; 3'UTR (exon 1)

  OTTHUMT00000446383 ; RBBP8-007; intron 2

  OTTHUMT00000446386 ; RBBP8-010; intron 2

  OTTHUMT00000446385 ; RBBP8-008; intron 3

  OTTHUMT00000446381 ; RBBP8-011; intron 4

  OTTHUMT00000446384 ; RBBP8-009; intron 4

  ENST00000327155 ; RBBP8-001; 3'UTR (exon 1)

  ENST00000327155 ; RBBP8-001; 3'UTR (exon 1)

  ENST00000327155 ; RBBP8-001; 3'UTR (exon 1)

  ENST00000579124 ; RBBP8-007; intron 2

  ENST00000581819 ; RBBP8-010; intron 2

  ENST00000582354 ; RBBP8-008; intron 3

  ENST00000583700 ; RBBP8-011; intron 4

  ENST00000577588 ; RBBP8-009; intron 4

  antisense

  OTTHUMT00000446412 ; RP11-739L10.1-001; intron 1

  ENST00000578831 ; RP11-739L10.1-001; intron 1

Database links

• ENTREZGENE: 100616139;MIR4741

Mature sequence hsa-miR-4741

• Accession: MIMAT0019871
• Sequence: 59 - cgggcuguccggaggggucggcu - 81
• Deep sequencing: 209 reads, 12 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4741
  • MIRDB:hsa-miR-4741
  • TARGETMINER:hsa-miR-4741

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).