|
miRBase |
|
Stem-loop sequence hsa-mir-4740 |
|||||
| Accession | MI0017378 | ||||
| Description | Homo sapiens miR-4740 stem-loop | ||||
| Stem-loop |
gc a u a gag a ca ggac gauccucucgggc gg uc g || |||| ||||||||||||| || || a gu ccug cuaggagagcccg cc gg g -c c c - --a g |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4740-5p |
|
| Accession | MIMAT0019869 |
| Sequence |
5 - aggacugauccucucgggcagg - 26 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4740-3p |
|
| Accession | MIMAT0019870 |
| Sequence |
42 - gcccgagaggauccgucccugc - 63 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|