Stem-loop sequence hsa-mir-4739

Accession MI0017377
Description Homo sapiens miR-4739 stem-loop
Stem-loop 
      aa  a         agc        c  u u 
gggagg  ga gggaggagg   ggaggggc cu g c
||||||  || |||||||||   |||||||| || | u
cccucc  cu cccuccuuc   ccucuccg ga c u
      cc  c         ---        a  c c
Get sequence
Deep sequencing
25 reads, 13 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 77680985-77681058 [-]
intergenic
Database links

Mature sequence hsa-miR-4739

Accession MIMAT0019868
Sequence

10 -  

aagggaggaggagcggaggggcccu

 - 34

Get sequence
Deep sequencing 11 reads, 8 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).