Stem-loop sequence hsa-mir-4738

Accession

MI0017376

Description

Homo sapiens miR-4738 stem-loop

Gene family

MIPF0001521; mir-4738

Stem-loop

    g a        ucuua    c      u         a    a 
gguc c uuucuccu     ccag gcguuu caguuucau ggga g
|||| | ||||||||     |||| |||||| ||||||||| |||| c
ccgg g gaagagga     gguc cgcgag gucaaagua ccuu c
    - -        -----    -      -         -    u 

Deep sequencing

6 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr17: 73780602-73780688 [-]
• Overlapping transcripts:

  antisense

  ENST00000293218 ; UNK-201; 3'UTR (exon 1)

  ENST00000293218 ; UNK-201; 3'UTR (exon 1)

Database links

• ENTREZGENE: 100616282;MIR4738

Mature sequence hsa-miR-4738-5p

• Accession: MIMAT0019866
• Sequence: 20 - accagcgcguuuucaguuucau - 41
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4738-5p
  • MIRDB:hsa-miR-4738-5p
  • TARGETMINER:hsa-miR-4738-5p

Mature sequence hsa-miR-4738-3p

• Accession: MIMAT0019867
• Sequence: 57 - ugaaacuggagcgccuggagga - 78
• Deep sequencing: 6 reads, 5 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4738-3p
  • MIRDB:hsa-miR-4738-3p
  • TARGETMINER:hsa-miR-4738-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).