Stem-loop sequence hsa-mir-3064

Accession MI0017375
Description Homo sapiens miR-3064 stem-loop
Gene family MIPF0001238; mir-3064
Stem-loop 
-g  cu  c     ug     -     cuc  u 
  gu  gg uguug  gugug caaaa   cg a
  ||  || |||||  ||||| |||||   || c
  ca  cc acaac  cacac guuuu   gu a
ga  uu  -     gu     c     auc  u
Get sequence
Deep sequencing
4 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 62496892-62496957 [-]
sense
OTTHUMT00000445044 ; DDX5-031; intron 2
OTTHUMT00000445045 ; DDX5-030; intron 2
OTTHUMT00000445077 ; DDX5-032; intron 2
OTTHUMT00000444973 ; DDX5-023; exon 5
OTTHUMT00000444027 ; DDX5-003; intron 10
OTTHUMT00000444028 ; DDX5-004; intron 10
OTTHUMT00000444031 ; DDX5-006; intron 10
OTTHUMT00000444029 ; DDX5-002; exon 11
OTTHUMT00000444030 ; DDX5-001; intron 11
OTTHUMT00000444032 ; DDX5-005; intron 11
ENST00000581130 ; MIR3064-202; exon 1
ENST00000580026 ; DDX5-031; intron 2
ENST00000578758 ; DDX5-030; intron 2
ENST00000581237 ; DDX5-032; intron 2
ENST00000578491 ; DDX5-023; exon 5
ENST00000450599 ; DDX5-202; intron 10
ENST00000450599 ; DDX5-202; intron 10
ENST00000540698 ; DDX5-003; intron 10
ENST00000581693 ; DDX5-004; intron 10
ENST00000450599 ; DDX5-006; intron 10
ENST00000540698 ; DDX5-203; intron 11
ENST00000540698 ; DDX5-203; intron 11
ENST00000581230 ; DDX5-002; exon 11
ENST00000225792 ; DDX5-001; intron 11
ENST00000578804 ; DDX5-005; intron 11
ENST00000225792 ; DDX5-201; intron 12
ENST00000225792 ; DDX5-201; intron 12
Clustered miRNAs
< 10kb from hsa-mir-3064
hsa-mir-5047 chr17: 62497332-62497431 [-]
hsa-mir-3064 chr17: 62496892-62496957 [-]
Database links

Mature sequence hsa-miR-3064-5p

Accession MIMAT0019864
Sequence

3 -  

ucuggcuguuguggugugcaa

 - 23

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-3064-3p

Accession MIMAT0019865
Sequence

43 -  

uugccacacugcaacaccuuaca

 - 65

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).