|
miRBase |
|
Stem-loop sequence hsa-mir-4734 |
|||||
| Accession | MI0017371 | ||||
| Description | Homo sapiens miR-4734 stem-loop | ||||
| Stem-loop |
---- - gcc c cg cucgg gccc gaccgc ggcccgca cucc g ||||| |||| |||||| |||||||| |||| gggcc cggg cuggcg ucgggcgu gagg c cuag a --- c cc |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4734 |
|
| Accession | MIMAT0019859 |
| Sequence |
41 - gcugcgggcugcggucagggcg - 62 |
| Deep sequencing | 10 reads, 4 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|