Stem-loop sequence hsa-mir-4731

Accession MI0017368
Description Homo sapiens miR-4731 stem-loop
Stem-loop 
           c          a  a     cag 
cccugccagug ugggggccac ug gugug   u
||||||||||| |||||||||| || |||||    
gggacggucac acccccggug ac cacac   c
           a          a  a     cua
Get sequence
Deep sequencing
5 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 15154944-15155013 [-]
sense
OTTHUMT00000130683 ; PMP22-004; intron 1
OTTHUMT00000130683 ; PMP22-004; intron 1
OTTHUMT00000130683 ; PMP22-004; intron 1
OTTHUMT00000442213 ; PMP22-006; intron 2
OTTHUMT00000130378 ; PMP22-001; intron 3
OTTHUMT00000130379 ; PMP22-002; intron 3
OTTHUMT00000130380 ; PMP22-003; intron 3
OTTHUMT00000130378 ; PMP22-001; intron 3
OTTHUMT00000130379 ; PMP22-002; intron 3
OTTHUMT00000130380 ; PMP22-003; intron 3
OTTHUMT00000130378 ; PMP22-001; intron 3
OTTHUMT00000130379 ; PMP22-002; intron 3
OTTHUMT00000130380 ; PMP22-003; intron 3
OTTHUMT00000442214 ; PMP22-008; intron 3
ENST00000494511 ; PMP22-004; intron 1
ENST00000494511 ; PMP22-004; intron 1
ENST00000494511 ; PMP22-004; intron 1
ENST00000580584 ; PMP22-006; intron 2
ENST00000395938 ; PMP22-001; intron 3
ENST00000312280 ; PMP22-002; intron 3
ENST00000395936 ; PMP22-003; intron 3
ENST00000426385 ; PMP22-201; intron 3
ENST00000395938 ; PMP22-001; intron 3
ENST00000312280 ; PMP22-002; intron 3
ENST00000395936 ; PMP22-003; intron 3
ENST00000426385 ; PMP22-201; intron 3
ENST00000395938 ; PMP22-001; intron 3
ENST00000312280 ; PMP22-002; intron 3
ENST00000395936 ; PMP22-003; intron 3
ENST00000426385 ; PMP22-008; intron 3
Database links

Mature sequence hsa-miR-4731-5p

Accession MIMAT0019853
Sequence

10 -  

ugcugggggccacaugagugug

 - 31

Get sequence
Deep sequencing 5 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4731-3p

Accession MIMAT0019854
Sequence

42 -  

cacacaaguggcccccaacacu

 - 63

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).