Stem-loop sequence hsa-mir-4728

Accession

MI0017365

Description

Homo sapiens miR-4728 stem-loop

Stem-loop

-- u   -     a    -     a  ---aca     
  g ggg agggg gagg cagca gc      cagg 
  | ||| ||||| |||| ||||| ||      ||| g
  c ccc uccuc cucc gucgu cg      gucc 
ga -   g     c    a     a  aucagg     

Deep sequencing

24 reads, 10 experiments

Genome context

• Coordinates (GRCh37.p5): chr17: 37882748-37882814 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000445617 ; ERBB2-004; intron 17

  OTTHUMT00000445618 ; ERBB2-005; intron 23

  OTTHUMT00000445621 ; ERBB2-008; intron 23

  OTTHUMT00000445622 ; ERBB2-007; intron 23

  OTTHUMT00000445614 ; ERBB2-001; intron 27

  ENST00000445658 ; ERBB2-203; intron 17

  ENST00000445658 ; ERBB2-203; intron 17

  ENST00000445658 ; ERBB2-004; intron 17

  ENST00000541774 ; ERBB2-206; intron 23

  ENST00000269571 ; ERBB2-201; intron 23

  ENST00000540147 ; ERBB2-205; intron 23

  ENST00000541774 ; ERBB2-206; intron 23

  ENST00000269571 ; ERBB2-201; intron 23

  ENST00000540147 ; ERBB2-205; intron 23

  ENST00000584450 ; ERBB2-005; intron 23

  ENST00000269571 ; ERBB2-008; intron 23

  ENST00000578373 ; ERBB2-007; intron 23

  ENST00000541774 ; ERBB2-204; intron 23

  ENST00000540147 ; ERBB2-203; intron 23

  ENST00000406381 ; ERBB2-202; intron 25

  ENST00000406381 ; ERBB2-202; intron 25

  ENST00000406381 ; ERBB2-201; intron 25

  ENST00000584601 ; ERBB2-001; intron 27

Database links

• ENTREZGENE: 100616132;MIR4728

Mature sequence hsa-miR-4728-5p

• Accession: MIMAT0019849
• Sequence: 2 - ugggaggggagaggcagcaagca - 24
• Deep sequencing: 15 reads, 7 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4728-5p
  • MIRDB:hsa-miR-4728-5p
  • TARGETMINER:hsa-miR-4728-5p

Mature sequence hsa-miR-4728-3p

• Accession: MIMAT0019850
• Sequence: 43 - caugcugaccucccuccugccccag - 67
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4728-3p
  • MIRDB:hsa-miR-4728-3p
  • TARGETMINER:hsa-miR-4728-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).