|
miRBase |
|
Stem-loop sequence hsa-mir-4727 |
|||||
| Accession | MI0017364 | ||||
| Description | Homo sapiens miR-4727 stem-loop | ||||
| Stem-loop |
- - a cag aaucugccagcuucc ac gugg a ||||||||||||||| || |||| u uuagacggucgaagg ug uacc u c g a cuu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4727-5p |
|
| Accession | MIMAT0019847 |
| Sequence |
2 - aucugccagcuuccacagugg - 22 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4727-3p |
|
| Accession | MIMAT0019848 |
| Sequence |
34 - auagugggaagcuggcagauuc - 55 |
| Deep sequencing | 12 reads, 4 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|