Stem-loop sequence hsa-mir-4726

Accession MI0017363
Description Homo sapiens miR-4726 stem-loop
Stem-loop 
-ag         -       a  --       
   ggccagagg agccugg gu  ggucgg 
   ||||||||| ||||||| ||  ||||| g
   ccggucucc uuggacc ca  ucagcu 
acg         c       -  ag
Get sequence
Deep sequencing
3 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 36875944-36876001 [+]
sense
OTTHUMT00000256801 ; MLLT6-003; intron 1
OTTHUMT00000256801 ; MLLT6-003; intron 1
OTTHUMT00000256801 ; MLLT6-003; intron 1
OTTHUMT00000256802 ; MLLT6-004; intron 3
OTTHUMT00000256802 ; MLLT6-004; intron 3
OTTHUMT00000256802 ; MLLT6-004; intron 3
OTTHUMT00000256803 ; MLLT6-005; intron 5
OTTHUMT00000256803 ; MLLT6-005; intron 5
OTTHUMT00000256799 ; MLLT6-001; intron 13
OTTHUMT00000256799 ; MLLT6-001; intron 13
OTTHUMT00000256799 ; MLLT6-001; intron 13
ENST00000494578 ; MLLT6-003; intron 1
ENST00000494578 ; MLLT6-003; intron 1
ENST00000494578 ; MLLT6-003; intron 1
ENST00000471200 ; MLLT6-004; intron 3
ENST00000471200 ; MLLT6-004; intron 3
ENST00000471200 ; MLLT6-004; intron 3
ENST00000484263 ; MLLT6-005; intron 5
ENST00000484263 ; MLLT6-005; intron 5
ENST00000325718 ; MLLT6-001; intron 13
ENST00000325718 ; MLLT6-001; intron 13
ENST00000325718 ; MLLT6-001; intron 13
antisense
OTTHUMT00000442306 ; CTB-58E17.9-001; intron 1
ENST00000579499 ; CTB-58E17.9-001; intron 1
Database links

Mature sequence hsa-miR-4726-5p

Accession MIMAT0019845
Sequence

1 -  

agggccagaggagccuggagugg

 - 23

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4726-3p

Accession MIMAT0019846
Sequence

37 -  

acccagguucccucuggccgca

 - 58

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).