|
miRBase |
|
Stem-loop sequence hsa-mir-4725 |
||||||
| Accession | MI0017362 | |||||
| Description | Homo sapiens miR-4725 stem-loop | |||||
| Stem-loop |
- ugga c ca - cca g ag gugu cucuc gac cug gccuuccc ac cca gg c |||| ||||| ||| ||| |||||||| || ||| || caca gggag cug gac cggaaggg ug ggu cc u a uggg u ug g ucg a uu |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-4725-5p |
|
| Accession | MIMAT0019843 |
| Sequence |
13 - agacccugcagccuucccacc - 33 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4725-3p |
|
| Accession | MIMAT0019844 |
| Sequence |
58 - uggggaaggcgucagugucggg - 79 |
| Deep sequencing | 13 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|