Stem-loop sequence hsa-mir-451b

Accession MI0017360
Description Homo sapiens miR-451b stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   u  a     ag    a           aa 
 ggg au gcaag  aacc uuaccauuacu  a
 ||| || |||||  |||| |||||||||||   
 ccc ua cguuc  uugg aaugguaauga  c
a   u  c     cu    c           cu 
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 27188389-27188456 [+]
sense
OTTHUMT00000447013 ; RP11-20B24.9-001; exon 1
ENST00000580595 ; MIR451B-001; exon 1
antisense
OTTHUMT00000446722 ; RP11-20B24.2-001; exon 1
ENST00000385059 ; MIR451-201; exon 1
ENST00000385059 ; MIR451A-201; exon 1
ENST00000582320 ; MIR451B-001; exon 1
ENST00000385059 ; MIR451A-201; exon 1
Clustered miRNAs
< 10kb from hsa-mir-451b
hsa-mir-451a chr17: 27188387-27188458 [-]
hsa-mir-451b chr17: 27188389-27188456 [+]
hsa-mir-144 chr17: 27188551-27188636 [-]
hsa-mir-4732 chr17: 27188673-27188748 [-]
Database links

Mature sequence hsa-miR-451b

Accession MIMAT0019840
Sequence

7 - 

uagcaagagaaccauuaccauu

 - 28

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).