Stem-loop sequence hsa-mir-451b

AccessionMI0017360 (change log)
Symbol HGNC:MIR451B
DescriptionHomo sapiens miR-451b stem-loop
Gene family MIPF0000148; mir-451
Literature search

242 open access papers mention hsa-mir-451b
(1167 sentences)

Stem-loop
   u   u  a     ag    a           aa 
5'  ggg au gcaag  aacc uuaccauuacu  a
    ||| || |||||  |||| |||||||||||   
3'  ccc ua cguuc  uugg aaugguaauga  c
   a   u  c     cu    c           cu 
Get sequence
Deep sequencing
720 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 28861371-28861438 [+]
sense
OTTHUMT00000443628 ; ALOX12P1-001; intron 3
ENST00000579299 ; ALOX12P1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-451b
hsa-mir-451achr17: 28861369-28861440 [-]
hsa-mir-451bchr17: 28861371-28861438 [+]
hsa-mir-144chr17: 28861533-28861618 [-]
hsa-mir-4732chr17: 28861655-28861730 [-]
Database links

Mature sequence hsa-miR-451b

Accession MIMAT0019840
Sequence

7 - 

uagcaagagaaccauuaccauu

 - 28

Get sequence
Deep sequencing715 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).