|
miRBase |
|
Stem-loop sequence hsa-mir-4723 |
|||||
| Accession | MI0017359 | ||||
| Description | Homo sapiens miR-4723 stem-loop | ||||
| Stem-loop |
ag u u uaa a cc agaa uugg gggggagcca gaga g gcaccu uag u |||| |||||||||| |||| | |||||| ||| g aacc ccuccucggu cucu c cgugga auc u ga - - --c - -a aagu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4723-5p |
|
| Accession | MIMAT0019838 |
| Sequence |
7 - ugggggagccaugagauaagagca - 30 |
| Deep sequencing | 11 reads, 7 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4723-3p |
|
| Accession | MIMAT0019839 |
| Sequence |
59 - cccucucuggcuccuccccaaa - 80 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|