|
miRBase |
|
Stem-loop sequence hsa-mir-4520b |
||||||
| Accession | MI0017358 | |||||
| Description | Homo sapiens miR-4520b stem-loop | |||||
| Gene family | MIPF0001272; mir-4520 | |||||
| Stem-loop |
- cu ccugcguguuuucuguccaaauc u ||||||||||||||||||||||| u ggacgcacaaaagacagguuuag u u uc |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-4520b-5p |
|
| Accession | MIMAT0020299 |
| Sequence |
1 - ccugcguguuuucuguccaa - 20 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4520b-3p |
|
| Accession | MIMAT0020300 |
| Sequence |
33 - uuuggacagaaaacacgcaggu - 54 |
| Deep sequencing | 2 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|