Stem-loop sequence hsa-mir-4722

Accession MI0017357
Description Homo sapiens miR-4722 stem-loop
Stem-loop 
-g     -   -    u  c     -    gg 
  gcagg agg gcug gc agguu ggcu  g
  ||||| ||| |||| || ||||| ||||   
  cgucc ucc cgac cg uccag ccgg  c
ga     c   a    -  -     u    ac
Get sequence
Deep sequencing
3 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 88782686-88782745 [-]
sense
OTTHUMT00000345711 ; FAM38A-013; intron 2
OTTHUMT00000345711 ; FAM38A-013; intron 2
OTTHUMT00000345711 ; FAM38A-013; intron 2
OTTHUMT00000345702 ; FAM38A-004; intron 4
OTTHUMT00000345702 ; FAM38A-004; intron 4
OTTHUMT00000345702 ; FAM38A-004; intron 4
OTTHUMT00000345701 ; FAM38A-003; intron 7
OTTHUMT00000345701 ; FAM38A-003; intron 7
OTTHUMT00000345701 ; FAM38A-003; intron 7
OTTHUMT00000345700 ; FAM38A-002; intron 23
OTTHUMT00000345700 ; FAM38A-002; intron 23
OTTHUMT00000345699 ; FAM38A-001; intron 46
OTTHUMT00000345699 ; FAM38A-001; intron 48
OTTHUMT00000345699 ; FAM38A-001; intron 48
ENST00000472168 ; FAM38A-013; intron 2
ENST00000472168 ; PIEZO1-013; intron 2
ENST00000472168 ; PIEZO1-013; intron 2
ENST00000484567 ; FAM38A-004; intron 4
ENST00000484567 ; PIEZO1-004; intron 4
ENST00000484567 ; PIEZO1-004; intron 4
ENST00000419505 ; FAM38A-003; intron 7
ENST00000327397 ; FAM38A-202; intron 7
ENST00000419505 ; PIEZO1-003; intron 7
ENST00000327397 ; PIEZO1-201; intron 7
ENST00000419505 ; PIEZO1-003; intron 7
ENST00000327397 ; PIEZO1-201; intron 7
ENST00000451779 ; PIEZO1-002; intron 23
ENST00000451779 ; PIEZO1-002; intron 23
ENST00000451779 ; FAM38A-001; intron 46
ENST00000301015 ; FAM38A-201; intron 48
ENST00000301015 ; PIEZO1-001; intron 48
ENST00000301015 ; PIEZO1-001; intron 48
Database links

Mature sequence hsa-miR-4722-5p

Accession MIMAT0019836
Sequence

1 -  

ggcaggagggcugugccagguug

 - 23

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4722-3p

Accession MIMAT0019837
Sequence

39 -  

accugccagcaccucccugcag

 - 60

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).