|
miRBase |
|
Stem-loop sequence hsa-mir-4721 |
|||||
| Accession | MI0017356 | ||||
| Description | Homo sapiens miR-4721 stem-loop | ||||
| Stem-loop |
ggg g g agcca - -aa - a ccug ucau guca gguuc cauc gcc ccacc g |||| |||| |||| ||||| |||| ||| ||||| ggac ggug cagu ucggg gugg cgg ggugg a uug g g ggacc a acc a a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4721 |
|
| Accession | MIMAT0019835 |
| Sequence |
60 - ugagggcuccaggugacggugg - 81 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|