Stem-loop sequence hsa-mir-4716

Accession

MI0017350

Description

Homo sapiens miR-4716 stem-loop

Gene family

MIPF0001476; mir-4716

Stem-loop

                                 ----     c 
cauacuuugucuccauguuuccuucccccuucu    guaua a
|||||||||||||||||||||||||||||||||    |||||  
gugugaaacagagguacaaaggaagggggaagg    cauau u
                                 agga     g 

Deep sequencing

5 reads, 4 experiments

Genome context

• Coordinates (GRCh37.p5): chr15: 49461267-49461350 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000417849 ; GALK2-001; intron 1

  OTTHUMT00000417852 ; GALK2-010; intron 1

  OTTHUMT00000417853 ; GALK2-011; intron 1

  OTTHUMT00000417849 ; GALK2-001; intron 1

  OTTHUMT00000417852 ; GALK2-010; intron 1

  OTTHUMT00000417853 ; GALK2-011; intron 1

  OTTHUMT00000417847 ; GALK2-007; intron 2

  OTTHUMT00000417848 ; GALK2-008; intron 2

  OTTHUMT00000417850 ; GALK2-022; intron 2

  OTTHUMT00000417851 ; GALK2-009; intron 2

  OTTHUMT00000417847 ; GALK2-007; intron 2

  OTTHUMT00000417848 ; GALK2-008; intron 2

  OTTHUMT00000417850 ; GALK2-022; intron 2

  OTTHUMT00000417851 ; GALK2-009; intron 2

  ENST00000327171 ; GALK2-201; intron 1

  ENST00000327171 ; GALK2-001; intron 1

  ENST00000561074 ; GALK2-010; intron 1

  ENST00000559040 ; GALK2-011; intron 1

  ENST00000327171 ; GALK2-001; intron 1

  ENST00000561074 ; GALK2-010; intron 1

  ENST00000559040 ; GALK2-011; intron 1

  ENST00000559883 ; GALK2-007; intron 2

  ENST00000559963 ; GALK2-008; intron 2

  ENST00000560654 ; GALK2-022; intron 2

  ENST00000558775 ; GALK2-009; intron 2

  ENST00000559883 ; GALK2-007; intron 2

  ENST00000559963 ; GALK2-008; intron 2

  ENST00000560654 ; GALK2-022; intron 2

  ENST00000558775 ; GALK2-009; intron 2

Database links

• ENTREZGENE: 100616332;MIR4716

Mature sequence hsa-miR-4716-5p

• Accession: MIMAT0019826
• Sequence: 12 - uccauguuuccuucccccuucu - 33
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4716-5p
  • MIRDB:hsa-miR-4716-5p
  • TARGETMINER:hsa-miR-4716-5p

Mature sequence hsa-miR-4716-3p

• Accession: MIMAT0019827
• Sequence: 54 - aagggggaaggaaacauggaga - 75
• Deep sequencing: 5 reads, 4 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4716-3p
  • MIRDB:hsa-miR-4716-3p
  • TARGETMINER:hsa-miR-4716-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).