Stem-loop sequence hsa-mir-4715

Accession

MI0017349

Description

Homo sapiens miR-4715 stem-loop

Stem-loop

       gaa                      -ua   a 
ggggaau   aguuggcugcaguuaagguggc   auc g
|||||||   ||||||||||||||||||||||   |||  
ccccuua   uuaaccgacgucaauuccaccg   uag c
       auc                      ugg   u 

Deep sequencing

2 reads, 2 experiments

Genome context

• Coordinates (GRCh37.p5): chr15: 26093894-26093972 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000414830 ; ATP10A-001; intron 1

  OTTHUMT00000414835 ; ATP10A-006; intron 1

  OTTHUMT00000414830 ; ATP10A-001; intron 1

  OTTHUMT00000414835 ; ATP10A-006; intron 1

  OTTHUMT00000414830 ; ATP10A-001; intron 1

  OTTHUMT00000414835 ; ATP10A-006; intron 1

  OTTHUMT00000414831 ; ATP10A-002; intron 2

  OTTHUMT00000414831 ; ATP10A-002; intron 2

  OTTHUMT00000414831 ; ATP10A-002; intron 2

  OTTHUMT00000414834 ; ATP10A-003; intron 4

  OTTHUMT00000414834 ; ATP10A-003; intron 4

  OTTHUMT00000414834 ; ATP10A-003; intron 4

  ENST00000356865 ; ATP10A-001; intron 1

  ENST00000553577 ; ATP10A-006; intron 1

  ENST00000356865 ; ATP10A-001; intron 1

  ENST00000553577 ; ATP10A-006; intron 1

  ENST00000356865 ; ATP10A-001; intron 1

  ENST00000553577 ; ATP10A-006; intron 1

  ENST00000555815 ; ATP10A-002; intron 2

  ENST00000555815 ; ATP10A-002; intron 2

  ENST00000555815 ; ATP10A-002; intron 2

  ENST00000389967 ; ATP10A-003; intron 4

  ENST00000389967 ; ATP10A-003; intron 4

  ENST00000389967 ; ATP10A-003; intron 4

Database links

• ENTREZGENE: 100616474;MIR4715

Mature sequence hsa-miR-4715-5p

• Accession: MIMAT0019824
• Sequence: 10 - aaguuggcugcaguuaaggugg - 31
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4715-5p
  • MIRDB:hsa-miR-4715-5p
  • TARGETMINER:hsa-miR-4715-5p

Mature sequence hsa-miR-4715-3p

• Accession: MIMAT0019825
• Sequence: 46 - gugccaccuuaacugcagccaau - 68
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4715-3p
  • MIRDB:hsa-miR-4715-3p
  • TARGETMINER:hsa-miR-4715-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).