Stem-loop sequence hsa-mir-4714

Accession MI0017348
Description Homo sapiens miR-4714 stem-loop
Stem-loop 
                   c         ----  g  a 
auuuuggccaacucugacc cuuagguug    au uc g
||||||||||||||||||| |||||||||    || || a
uaaaaccgguugagacugg ggauccaac    ug ag a
                   u         caug  g  u
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 99327655-99327731 [+]
sense
OTTHUMT00000415752 ; IGF1R-017; intron 1
OTTHUMT00000415412 ; IGF1R-014; intron 1
OTTHUMT00000415752 ; IGF1R-017; intron 1
OTTHUMT00000415412 ; IGF1R-014; intron 1
OTTHUMT00000313537 ; IGF1R-001; intron 2
OTTHUMT00000313537 ; IGF1R-001; intron 2
OTTHUMT00000415271 ; IGF1R-002; intron 2
OTTHUMT00000415411 ; IGF1R-003; intron 2
OTTHUMT00000313537 ; IGF1R-001; intron 2
OTTHUMT00000415271 ; IGF1R-002; intron 2
OTTHUMT00000415411 ; IGF1R-003; intron 2
ENST00000558355 ; IGF1R-017; intron 1
ENST00000557938 ; IGF1R-014; intron 1
ENST00000558355 ; IGF1R-017; intron 1
ENST00000557938 ; IGF1R-014; intron 1
ENST00000268035 ; IGF1R-001; intron 2
ENST00000268035 ; IGF1R-001; intron 2
ENST00000558762 ; IGF1R-002; intron 2
ENST00000559925 ; IGF1R-003; intron 2
ENST00000268035 ; IGF1R-001; intron 2
ENST00000558762 ; IGF1R-002; intron 2
ENST00000559925 ; IGF1R-003; intron 2
Database links

Mature sequence hsa-miR-4714-5p

Accession MIMAT0019822
Sequence

10 -  

aacucugaccccuuagguugau

 - 31

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4714-3p

Accession MIMAT0019823
Sequence

48 -  

ccaaccuagguggucagaguug

 - 69

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).