|
miRBase |
|
Stem-loop sequence hsa-mir-4713 |
|||||
| Accession | MI0017347 | ||||
| Description | Homo sapiens miR-4713 stem-loop | ||||
| Stem-loop |
ac a c aag guccccauuuuucucccacu c gg ucccau g |||||||||||||||||||| | || |||||| g cagggguaaaaagaggguga g cc agggua u ca a u agc |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4713-5p |
|
| Accession | MIMAT0019820 |
| Sequence |
11 - uucucccacuaccaggcuccca - 32 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4713-3p |
|
| Accession | MIMAT0019821 |
| Sequence |
44 - ugggauccagacagugggagaa - 65 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|