Stem-loop sequence hsa-mir-4711

Accession MI0017345
Description Homo sapiens miR-4711 stem-loop
Stem-loop 
                            c    u 
aaaugugcaucaggccagaagacaugag ccuu g
|||||||||||||||||||||||||||| ||||  
uuuacacguaguucggucuucugugcuc ggaa g
                            u    a
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 60198899-60198968 [-]
antisense
OTTHUMT00000024220 ; FGGY-017; intron 1
OTTHUMT00000024220 ; FGGY-017; intron 1
OTTHUMT00000024220 ; FGGY-017; intron 1
OTTHUMT00000023770 ; FGGY-012; intron 2
OTTHUMT00000023771 ; FGGY-013; intron 2
OTTHUMT00000023770 ; FGGY-012; intron 2
OTTHUMT00000023771 ; FGGY-013; intron 2
OTTHUMT00000023770 ; FGGY-012; intron 2
OTTHUMT00000023771 ; FGGY-013; intron 2
OTTHUMT00000024218 ; FGGY-015; intron 4
OTTHUMT00000024218 ; FGGY-015; intron 4
OTTHUMT00000024218 ; FGGY-015; intron 4
OTTHUMT00000023207 ; FGGY-002; intron 8
OTTHUMT00000023207 ; FGGY-002; intron 8
OTTHUMT00000023207 ; FGGY-002; intron 8
OTTHUMT00000023211 ; FGGY-006; intron 12
OTTHUMT00000023211 ; FGGY-006; intron 12
OTTHUMT00000023211 ; FGGY-006; intron 12
OTTHUMT00000023210 ; FGGY-001; intron 14
OTTHUMT00000023210 ; FGGY-001; intron 14
OTTHUMT00000023210 ; FGGY-001; intron 14
OTTHUMT00000023206 ; FGGY-005; intron 15
OTTHUMT00000023206 ; FGGY-005; intron 15
OTTHUMT00000023206 ; FGGY-005; intron 15
ENST00000476939 ; FGGY-017; intron 1
ENST00000476939 ; FGGY-017; intron 1
ENST00000476939 ; FGGY-017; intron 1
ENST00000472783 ; FGGY-012; intron 2
ENST00000471169 ; FGGY-013; intron 2
ENST00000472783 ; FGGY-012; intron 2
ENST00000471169 ; FGGY-013; intron 2
ENST00000472783 ; FGGY-012; intron 2
ENST00000471169 ; FGGY-013; intron 2
ENST00000493891 ; FGGY-015; intron 4
ENST00000493891 ; FGGY-015; intron 4
ENST00000493891 ; FGGY-015; intron 4
ENST00000371210 ; FGGY-002; intron 8
ENST00000371210 ; FGGY-002; intron 8
ENST00000371210 ; FGGY-002; intron 8
ENST00000371212 ; FGGY-006; intron 12
ENST00000371212 ; FGGY-006; intron 12
ENST00000371212 ; FGGY-006; intron 12
ENST00000303721 ; FGGY-001; intron 14
ENST00000303721 ; FGGY-001; intron 14
ENST00000303721 ; FGGY-001; intron 14
ENST00000371218 ; FGGY-005; intron 15
ENST00000371218 ; FGGY-005; intron 15
ENST00000371218 ; FGGY-005; intron 15
Database links

Mature sequence hsa-miR-4711-5p

Accession MIMAT0019816
Sequence

6 -  

ugcaucaggccagaagacaugag

 - 28

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4711-3p

Accession MIMAT0019817
Sequence

45 -  

cgugucuucuggcuugau

 - 62

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).