Stem-loop sequence hsa-mir-203b

AccessionMI0017343 (change log)
Previous IDshsa-mir-3545
Symbol HGNC:MIR203B
DescriptionHomo sapiens miR-203b stem-loop
Gene family MIPF0000108; mir-203
Literature search

287 open access papers mention hsa-mir-203b
(2507 sentences)

Stem-loop
       cc  c            c  a    u    -  a  g gc 
5' gcgc  gc gggucuaguggu cu aaca uuca ca uu c  u
   ||||  || |||||||||||| || |||| |||| || || |   
3' cgcg  cg cccaggucacca ga uugu aagu gu aa g  a
       --  a            a  a    c    u  c  - ac 
Get sequence
Deep sequencing
711 reads, 0 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 104117418-104117503 [-]
antisense
OTTHUMT00000414859 ; KLC1-021; intron 1
OTTHUMT00000402947 ; KLC1-001; intron 1
OTTHUMT00000402944 ; KLC1-003; intron 1
OTTHUMT00000414860 ; KLC1-022; intron 1
OTTHUMT00000402945 ; KLC1-002; intron 1
OTTHUMT00000414861 ; KLC1-009; intron 1
OTTHUMT00000414862 ; KLC1-008; intron 1
OTTHUMT00000402946 ; KLC1-005; intron 1
OTTHUMT00000414863 ; KLC1-016; intron 1
OTTHUMT00000414864 ; KLC1-010; intron 1
OTTHUMT00000414866 ; KLC1-011; intron 1
OTTHUMT00000414867 ; KLC1-013; intron 1
OTTHUMT00000414868 ; KLC1-020; intron 1
OTTHUMT00000402950 ; KLC1-004; intron 1
OTTHUMT00000414869 ; KLC1-017; intron 1
OTTHUMT00000414871 ; KLC1-015; intron 1
OTTHUMT00000402943 ; RP11-73M18.2-001; intron 4
ENST00000557172 ; KLC1-021; intron 1
ENST00000348520 ; KLC1-001; intron 1
ENST00000380038 ; KLC1-003; intron 1
ENST00000555467 ; KLC1-022; intron 1
ENST00000389744 ; KLC1-002; intron 1
ENST00000557575 ; KLC1-009; intron 1
ENST00000553286 ; KLC1-008; intron 1
ENST00000347839 ; KLC1-005; intron 1
ENST00000555836 ; KLC1-016; intron 1
ENST00000334553 ; KLC1-010; intron 1
ENST00000246489 ; KLC1-011; intron 1
ENST00000554228 ; KLC1-013; intron 1
ENST00000557450 ; KLC1-020; intron 1
ENST00000452929 ; KLC1-004; intron 1
ENST00000554280 ; KLC1-017; intron 1
ENST00000445352 ; KLC1-015; intron 1
ENST00000472726 ; RP11-73M18.2-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-203b
hsa-mir-203bchr14: 104117418-104117503 [-]
hsa-mir-203achr14: 104117405-104117514 [+]
Database links

Mature sequence hsa-miR-203b-5p

Accession MIMAT0019813
Previous IDshsa-miR-3545-5p
Sequence

15 - 

uagugguccuaaacauuucaca

 - 36

Get sequence
Deep sequencing56 reads, 16 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-203b-3p

Accession MIMAT0019814
Previous IDshsa-miR-3545-3p
Sequence

54 - 

uugaacuguuaagaaccacugga

 - 76

Get sequence
Deep sequencing649 reads, 68 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).