Stem-loop sequence hsa-mir-203b

Accession MI0017343
Previous IDs hsa-mir-3545
Description Homo sapiens miR-203b stem-loop
Gene family MIPF0000108; mir-203
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-203. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-203 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, such as translational repression and Argonaute-catalyzed messenger RNA cleavage. miR-203 has been identified as a skin-specific microRNA, and it forms an expression gradient that defines the boundary between proliferative epidermal basal progenitors and terminally differentiating suprabasal cells. It has also been found upregulated in psoriasis and differentially expressed in some types of cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    cc  c            c  a    u    -  a  g gc 
gcgc  gc gggucuaguggu cu aaca uuca ca uu c  u
||||  || |||||||||||| || |||| |||| || || |   
cgcg  cg cccaggucacca ga uugu aagu gu aa g  a
    --  a            a  a    c    u  c  - ac 
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 104583755-104583840 [-]
antisense
ENST00000384836 ; MIR203-201; exon 1
ENST00000384836 ; MIR203-201; exon 1
ENST00000384836 ; MIR203-201; exon 1
Clustered miRNAs
< 10kb from hsa-mir-203b
hsa-mir-203b chr14: 104583755-104583840 [-]
hsa-mir-203a chr14: 104583742-104583851 [+]
Database links

Mature sequence hsa-miR-203b-5p

Accession MIMAT0019813
Previous IDs hsa-miR-3545-5p
Sequence

15 - 

uagugguccuaaacauuucaca

 - 36

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-203b-3p

Accession MIMAT0019814
Previous IDs hsa-miR-3545-3p
Sequence

54 - 

uugaacuguuaagaaccacugga

 - 76

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).