Stem-loop sequence hsa-mir-4706

Accession MI0017339
Description Homo sapiens miR-4706 stem-loop
Stem-loop 
         ag     -    a      -   g     gcg 
gcuacgggg  cgggg agga gugggc gcu cuucu   u
|||||||||  ||||| |||| |||||| ||| |||||   u
uggugucuc  guccu uccu cacccg cga gaagg   a
         gg     g    -      a   g     ucu
Get sequence
Deep sequencing
22 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 65511406-65511487 [+]
sense
OTTHUMT00000414325 ; FNTB-002; intron 7
OTTHUMT00000414325 ; FNTB-002; intron 7
OTTHUMT00000414325 ; FNTB-002; intron 7
OTTHUMT00000286392 ; FNTB-001; intron 9
OTTHUMT00000286392 ; FNTB-001; intron 9
OTTHUMT00000286392 ; FNTB-001; intron 9
OTTHUMT00000408067 ; RP11-840I19.2-002; intron 10
OTTHUMT00000408067 ; RP11-840I19.2-002; intron 10
OTTHUMT00000408067 ; RP11-840I19.2-002; intron 10
OTTHUMT00000408068 ; RP11-840I19.2-001; intron 11
OTTHUMT00000408068 ; RP11-840I19.2-001; intron 11
OTTHUMT00000408068 ; RP11-840I19.2-001; intron 11
ENST00000448390 ; FNTB-202; intron 7
ENST00000554334 ; AL139022.1-002; intron 7
ENST00000448390 ; CHURC1-FNTB-202; intron 7
ENST00000554334 ; FNTB-002; intron 7
ENST00000448390 ; CHURC1-FNTB-202; intron 7
ENST00000554334 ; FNTB-002; intron 7
ENST00000246166 ; AL139022.1-001; intron 9
ENST00000246166 ; FNTB-001; intron 9
ENST00000246166 ; FNTB-001; intron 9
ENST00000552941 ; FNTB-002; intron 10
ENST00000542227 ; FNTB-203; intron 10
ENST00000552941 ; CHURC1-FNTB-002; intron 10
ENST00000542227 ; CHURC1-FNTB-203; intron 10
ENST00000552941 ; CHURC1-FNTB-002; intron 10
ENST00000542227 ; CHURC1-FNTB-203; intron 10
ENST00000549987 ; FNTB-001; intron 11
ENST00000447296 ; FNTB-201; intron 11
ENST00000549987 ; CHURC1-FNTB-001; intron 11
ENST00000447296 ; CHURC1-FNTB-201; intron 11
ENST00000549987 ; CHURC1-FNTB-001; intron 11
ENST00000447296 ; CHURC1-FNTB-201; intron 11
antisense
OTTHUMT00000286387 ; MAX-003; intron 3
OTTHUMT00000286387 ; MAX-003; intron 3
OTTHUMT00000286387 ; MAX-003; intron 3
ENST00000341653 ; MAX-003; intron 3
ENST00000341653 ; MAX-003; intron 3
ENST00000341653 ; MAX-003; intron 3
Database links

Mature sequence hsa-miR-4706

Accession MIMAT0019806
Sequence

10 -  

agcggggaggaagugggcgcugcuu

 - 34

Get sequence
Deep sequencing 22 reads, 7 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).