Stem-loop sequence hsa-mir-4705

Accession MI0017338
Description Homo sapiens miR-4705 stem-loop
Stem-loop 
                              u au 
cucacaagaucaaucacuugguaauugcug g  a
|||||||||||||||||||||||||||||| |  a
gaguguuuugguuagugaaccauuaacgac c  c
                              u aa
Get sequence
Deep sequencing
5 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 102698284-102698354 [-]
sense
OTTHUMT00000045680 ; FGF14-002; intron 1
OTTHUMT00000045680 ; FGF14-002; intron 1
OTTHUMT00000045680 ; FGF14-002; intron 1
ENST00000376131 ; FGF14-002; intron 1
ENST00000376131 ; FGF14-002; intron 1
ENST00000376131 ; FGF14-002; intron 1
Database links

Mature sequence hsa-miR-4705

Accession MIMAT0019805
Sequence

10 -  

ucaaucacuugguaauugcugu

 - 31

Get sequence
Deep sequencing 5 reads, 4 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).