Stem-loop sequence hsa-mir-4705

AccessionMI0017338 (change log)
Symbol HGNC:MIR4705
DescriptionHomo sapiens miR-4705 stem-loop
Literature search

1 open access papers mention hsa-mir-4705
(1 sentences)

Stem-loop
                                 u au 
5' cucacaagaucaaucacuugguaauugcug g  a
   |||||||||||||||||||||||||||||| |  a
3' gaguguuuugguuagugaaccauuaacgac c  c
                                 u aa 
Get sequence
Deep sequencing
152 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 102045934-102046004 [-]
sense
OTTHUMT00000045663 ; NALCN-001; intron 3
OTTHUMT00000045664 ; NALCN-002; intron 3
OTTHUMT00000045665 ; NALCN-003; intron 3
ENST00000376200 ; NALCN-202; intron 2
ENST00000251127 ; NALCN-001; intron 3
ENST00000497170 ; NALCN-002; intron 3
ENST00000470333 ; NALCN-003; intron 3
ENST00000376196 ; NALCN-201; intron 3
Database links

Mature sequence hsa-miR-4705

Accession MIMAT0019805
Sequence

10 - 

ucaaucacuugguaauugcugu

 - 31

Get sequence
Deep sequencing151 reads, 51 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).