Stem-loop sequence hsa-mir-4700

Accession MI0017333
Description Homo sapiens miR-4700 stem-loop
Stem-loop 
--uca   aggu      a      ca  gu      aa 
     gug    cugggg ugagga  gu  guccug  a
     |||    |||||| ||||||  ||  ||||||  u
     cac    gacccc acuccu  ca  caggac  u
aggag   --gu      -      --  gu      ac
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 121160996-121161069 [+]
sense
OTTHUMT00000402857 ; UNC119B-001; exon 5
OTTHUMT00000402857 ; UNC119B-001; exon 5
OTTHUMT00000402857 ; UNC119B-001; exon 5
ENST00000344651 ; UNC119B-001; exon 5
ENST00000537794 ; UNC119B-201; intron 5
ENST00000344651 ; UNC119B-001; exon 5
ENST00000537794 ; UNC119B-201; intron 5
ENST00000344651 ; UNC119B-001; exon 5
ENST00000537794 ; UNC119B-201; intron 5
antisense
OTTHUMT00000402860 ; RP11-173P15.5-001; intron 1
OTTHUMT00000402860 ; RP11-173P15.5-001; intron 1
OTTHUMT00000402860 ; RP11-173P15.5-001; intron 1
ENST00000544939 ; RP11-173P15.5-001; intron 1
ENST00000544939 ; RP11-173P15.5-001; intron 1
ENST00000544939 ; RP11-173P15.5-001; intron 1
Database links

Mature sequence hsa-miR-4700-5p

Accession MIMAT0019796
Sequence

10 -  

ucuggggaugaggacagugugu

 - 31

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4700-3p

Accession MIMAT0019797
Sequence

41 -  

cacaggacugacuccucaccccagug

 - 66

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).