Stem-loop sequence hsa-mir-4698

Accession MI0017331
Description Homo sapiens miR-4698 stem-loop
Stem-loop 
u      c                     cc      ac 
 gcuucu cuggggucuuccucuacauuu  accuag  g
 |||||| |||||||||||||||||||||  ||||||   
 cgagga gaccccagaaggagauguaaa  uggguc  g
a      a                     ac      cg
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 47581595-47581674 [+]
sense
OTTHUMT00000405079 ; FAM113B-001; intron 2
OTTHUMT00000405079 ; FAM113B-001; intron 2
OTTHUMT00000405079 ; FAM113B-001; intron 2
ENST00000546455 ; FAM113B-001; intron 2
ENST00000546455 ; FAM113B-001; intron 2
ENST00000546455 ; PCED1B-001; intron 2
Database links

Mature sequence hsa-miR-4698

Accession MIMAT0019793
Sequence

49 -  

ucaaaauguagaggaagacccca

 - 71

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).