Stem-loop sequence hsa-mir-4696

Accession

MI0017329

Description

Homo sapiens miR-4696 stem-loop

Stem-loop

                c     c        auu 
caaagccacugcaaga ggaua ugucaucu   c
|||||||||||||||| ||||| ||||||||    
guuucggugacguuuu ccugu acaguaga   c
                a     a        aga 

Genome context

• Coordinates (GRCh37.p5): chr11: 74431313-74431382 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000385390 ; CHRDL2-001; intron 1

  OTTHUMT00000385391 ; CHRDL2-002; intron 1

  OTTHUMT00000385392 ; CHRDL2-004; intron 1

  OTTHUMT00000385395 ; CHRDL2-003; intron 1

  OTTHUMT00000385390 ; CHRDL2-001; intron 1

  OTTHUMT00000385391 ; CHRDL2-002; intron 1

  OTTHUMT00000385392 ; CHRDL2-004; intron 1

  OTTHUMT00000385395 ; CHRDL2-003; intron 1

  OTTHUMT00000385390 ; CHRDL2-001; intron 1

  OTTHUMT00000385391 ; CHRDL2-002; intron 1

  OTTHUMT00000385392 ; CHRDL2-004; intron 1

  OTTHUMT00000385395 ; CHRDL2-003; intron 1

  ENST00000263671 ; CHRDL2-001; intron 1

  ENST00000376332 ; CHRDL2-002; intron 1

  ENST00000534159 ; CHRDL2-004; intron 1

  ENST00000528789 ; CHRDL2-003; intron 1

  ENST00000393519 ; CHRDL2-202; intron 1

  ENST00000263671 ; CHRDL2-001; intron 1

  ENST00000376332 ; CHRDL2-002; intron 1

  ENST00000534159 ; CHRDL2-004; intron 1

  ENST00000528789 ; CHRDL2-003; intron 1

  ENST00000393519 ; CHRDL2-202; intron 1

  ENST00000263671 ; CHRDL2-001; intron 1

  ENST00000376332 ; CHRDL2-002; intron 1

  ENST00000534159 ; CHRDL2-004; intron 1

  ENST00000528789 ; CHRDL2-003; intron 1

Database links

• ENTREZGENE: 100616402;MIR4696

Mature sequence hsa-miR-4696

• Accession: MIMAT0019790
• Sequence: 10 - ugcaagacggauacugucaucu - 31
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4696
  • MIRDB:hsa-miR-4696
  • TARGETMINER:hsa-miR-4696

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).