Stem-loop sequence hsa-mir-4695

Accession MI0017328
Description Homo sapiens miR-4695 stem-loop
Stem-loop 
ccugc            gc   --     --gg    gc 
     aggaggcagugg  gag  caggc    ggca  c
     ||||||||||||  |||  |||||    ||||   
     uccuccgucgcc  cuc  guccg    ccgu  c
-cccu            -a   ua     ggua    aa
Get sequence
Deep sequencing
150 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 19209696-19209769 [-]
sense
OTTHUMT00000006957 ; ALDH4A1-004; intron 2
OTTHUMT00000006957 ; ALDH4A1-004; intron 2
OTTHUMT00000006957 ; ALDH4A1-004; intron 2
OTTHUMT00000006956 ; ALDH4A1-003; intron 5
OTTHUMT00000006956 ; ALDH4A1-003; intron 5
OTTHUMT00000006956 ; ALDH4A1-003; intron 5
OTTHUMT00000006955 ; ALDH4A1-002; intron 6
OTTHUMT00000006954 ; ALDH4A1-001; intron 6
OTTHUMT00000006955 ; ALDH4A1-002; intron 6
OTTHUMT00000006954 ; ALDH4A1-001; intron 6
OTTHUMT00000006955 ; ALDH4A1-002; intron 6
OTTHUMT00000006954 ; ALDH4A1-001; intron 6
OTTHUMT00000393307 ; RP13-279N23.2-001; intron 14
OTTHUMT00000393307 ; RP13-279N23.2-001; intron 14
OTTHUMT00000393307 ; RP13-279N23.2-001; intron 14
ENST00000454547 ; ALDH4A1-004; intron 2
ENST00000454547 ; ALDH4A1-004; intron 2
ENST00000454547 ; ALDH4A1-004; intron 2
ENST00000432718 ; ALDH4A1-003; intron 5
ENST00000375335 ; ALDH4A1-202; intron 5
ENST00000432718 ; ALDH4A1-003; intron 5
ENST00000375335 ; ALDH4A1-202; intron 5
ENST00000432718 ; ALDH4A1-003; intron 5
ENST00000290597 ; ALDH4A1-002; intron 6
ENST00000375341 ; ALDH4A1-001; intron 6
ENST00000538839 ; ALDH4A1-204; intron 6
ENST00000538309 ; ALDH4A1-203; intron 6
ENST00000375334 ; ALDH4A1-201; intron 6
ENST00000290597 ; ALDH4A1-002; intron 6
ENST00000375341 ; ALDH4A1-001; intron 6
ENST00000538839 ; ALDH4A1-204; intron 6
ENST00000538309 ; ALDH4A1-203; intron 6
ENST00000375334 ; ALDH4A1-201; intron 6
ENST00000290597 ; ALDH4A1-002; intron 6
ENST00000375341 ; ALDH4A1-001; intron 6
ENST00000538839 ; ALDH4A1-202; intron 6
ENST00000538309 ; ALDH4A1-201; intron 6
ENST00000494072 ; RP13-279N23.2-001; intron 14
ENST00000494072 ; RP13-279N23.2-001; intron 14
ENST00000494072 ; RP13-279N23.2-001; intron 14
Database links

Mature sequence hsa-miR-4695-5p

Accession MIMAT0019788
Sequence

5 -  

caggaggcagugggcgagcagg

 - 26

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4695-3p

Accession MIMAT0019789
Sequence

51 -  

ugaucucaccgcugccuccuuc

 - 72

Get sequence
Deep sequencing 150 reads, 6 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).