Stem-loop sequence hsa-mir-4695

AccessionMI0017328 (change log)
Symbol HGNC:MIR4695
DescriptionHomo sapiens miR-4695 stem-loop
Literature search

2 open access papers mention hsa-mir-4695
(2 sentences)

Stem-loop
   ccugc            gc   --     --gg    gc 
5'      aggaggcagugg  gag  caggc    ggca  c
        ||||||||||||  |||  |||||    ||||   
3'      uccuccgucgcc  cuc  guccg    ccgu  c
   -cccu            -a   ua     ggua    aa 
Get sequence
Deep sequencing
3969 reads, 2.2 reads per million, 91 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 18883202-18883275 [-]
intergenic
Database links

Mature sequence hsa-miR-4695-5p

Accession MIMAT0019788
Sequence

5 - 

caggaggcagugggcgagcagg

 - 26

Get sequence
Deep sequencing24 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4695-3p

Accession MIMAT0019789
Sequence

51 - 

ugaucucaccgcugccuccuuc

 - 72

Get sequence
Deep sequencing3942 reads, 101 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).