Stem-loop sequence hsa-mir-4694

Accession

MI0017327

Description

Homo sapiens miR-4694 stem-loop

Stem-loop

                     a        c    cuca 
caaauacauagguguuauccu uccauuug cucu    g
||||||||||||||||||||| |||||||| ||||     
guuuauguauccacaauagga agguaaac gaga    a
                     c        u    uaaa 

Genome context

• Coordinates (GRCh37.p5): chr11: 19781550-19781629 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000389876 ; NAV2-008; intron 1

  OTTHUMT00000324113 ; NAV2-002; intron 1

  OTTHUMT00000324114 ; NAV2-003; intron 1

  OTTHUMT00000324112 ; NAV2-001; intron 1

  OTTHUMT00000389876 ; NAV2-008; intron 1

  OTTHUMT00000324113 ; NAV2-002; intron 1

  OTTHUMT00000324114 ; NAV2-003; intron 1

  OTTHUMT00000324112 ; NAV2-001; intron 1

  OTTHUMT00000389876 ; NAV2-008; intron 1

  OTTHUMT00000324113 ; NAV2-002; intron 1

  OTTHUMT00000324114 ; NAV2-003; intron 1

  OTTHUMT00000324112 ; NAV2-001; intron 1

  ENST00000360655 ; NAV2-008; intron 1

  ENST00000396085 ; NAV2-002; intron 1

  ENST00000349880 ; NAV2-003; intron 1

  ENST00000396087 ; NAV2-001; intron 1

  ENST00000360655 ; NAV2-008; intron 1

  ENST00000396085 ; NAV2-002; intron 1

  ENST00000349880 ; NAV2-003; intron 1

  ENST00000396087 ; NAV2-001; intron 1

  ENST00000360655 ; NAV2-008; intron 1

  ENST00000396085 ; NAV2-002; intron 1

  ENST00000349880 ; NAV2-003; intron 1

  ENST00000396087 ; NAV2-001; intron 1

Database links

• ENTREZGENE: 100616426;MIR4694

Mature sequence hsa-miR-4694-5p

• Accession: MIMAT0019786
• Sequence: 10 - agguguuauccuauccauuugc - 31
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4694-5p
  • MIRDB:hsa-miR-4694-5p
  • TARGETMINER:hsa-miR-4694-5p

Mature sequence hsa-miR-4694-3p

• Accession: MIMAT0019787
• Sequence: 51 - caaauggacaggauaacaccu - 71
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4694-3p
  • MIRDB:hsa-miR-4694-3p
  • TARGETMINER:hsa-miR-4694-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).