Stem-loop sequence hsa-mir-4693

Accession

MI0017326

Description

Homo sapiens miR-4693 stem-loop

Stem-loop

    aaa                   g    aaauu 
guuu   gaauacugugaauuucacu ucac     c
||||   ||||||||||||||||||| ||||     a
uaag   uuuaugacacuuaagguga agug     a
    gaa                   g    aaaua 

Genome context

• Coordinates (GRCh37.p5): chr11: 103720634-103720708 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000387230 ; RP11-563P16.1-001; intron 2

  OTTHUMT00000387230 ; RP11-563P16.1-001; intron 2

  OTTHUMT00000387230 ; RP11-563P16.1-001; intron 2

  ENST00000533459 ; RP11-563P16.1-001; intron 2

  ENST00000533459 ; RP11-563P16.1-001; intron 2

  ENST00000533459 ; RP11-563P16.1-001; intron 2

Database links

• ENTREZGENE: 100616457;MIR4693

Mature sequence hsa-miR-4693-5p

• Accession: MIMAT0019784
• Sequence: 10 - auacugugaauuucacugucaca - 32
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4693-5p
  • MIRDB:hsa-miR-4693-5p
  • TARGETMINER:hsa-miR-4693-5p

Mature sequence hsa-miR-4693-3p

• Accession: MIMAT0019785
• Sequence: 46 - ugagaguggaauucacaguauuu - 68
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4693-3p
  • MIRDB:hsa-miR-4693-3p
  • TARGETMINER:hsa-miR-4693-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).