Stem-loop sequence hsa-mir-4691

Accession

MI0017324

Description

Homo sapiens miR-4691 stem-loop

Stem-loop

   g      cag uc   -   g  a  a    c  cccu a 
gga cacucc   g  cuc cag cc ug gcug gg    g u
||| ||||||   |  ||| ||| || || |||| ||    |  
ccu gugagg   c  gag guc gg ac cgac uc    c g
   -      aua gu   a   a  c  -    c  aucu u 

Deep sequencing

23 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 67801364-67801448 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000394208 ; NDUFS8-004; intron 1

  OTTHUMT00000394215 ; NDUFS8-007; intron 1

  OTTHUMT00000394216 ; NDUFS8-006; exon 1

  OTTHUMT00000394208 ; NDUFS8-004; intron 1

  OTTHUMT00000394215 ; NDUFS8-007; intron 1

  OTTHUMT00000394216 ; NDUFS8-006; exon 1

  OTTHUMT00000394208 ; NDUFS8-004; intron 1

  OTTHUMT00000394215 ; NDUFS8-007; intron 1

  OTTHUMT00000394216 ; NDUFS8-006; exon 1

  OTTHUMT00000394209 ; NDUFS8-003; exon 3

  OTTHUMT00000394212 ; NDUFS8-013; intron 3

  OTTHUMT00000394209 ; NDUFS8-003; exon 3

  OTTHUMT00000394212 ; NDUFS8-013; intron 3

  OTTHUMT00000394209 ; NDUFS8-003; exon 3

  OTTHUMT00000394212 ; NDUFS8-013; intron 3

  OTTHUMT00000394214 ; NDUFS8-009; intron 4

  OTTHUMT00000394214 ; NDUFS8-009; intron 4

  OTTHUMT00000394214 ; NDUFS8-009; intron 4

  OTTHUMT00000394193 ; NDUFS8-001; intron 5

  OTTHUMT00000394207 ; NDUFS8-008; intron 5

  OTTHUMT00000394211 ; NDUFS8-015; intron 5

  OTTHUMT00000394193 ; NDUFS8-001; intron 5

  OTTHUMT00000394207 ; NDUFS8-008; intron 5

  OTTHUMT00000394211 ; NDUFS8-015; intron 5

  OTTHUMT00000394193 ; NDUFS8-001; intron 5

  OTTHUMT00000394207 ; NDUFS8-008; intron 5

  OTTHUMT00000394211 ; NDUFS8-015; intron 5

  ENST00000528492 ; NDUFS8-004; intron 1

  ENST00000524810 ; NDUFS8-007; intron 1

  ENST00000526542 ; NDUFS8-006; exon 1

  ENST00000526542 ; NDUFS8-006; exon 1

  ENST00000524810 ; NDUFS8-007; intron 1

  ENST00000528492 ; NDUFS8-004; intron 1

  ENST00000528492 ; NDUFS8-004; intron 1

  ENST00000524810 ; NDUFS8-007; intron 1

  ENST00000526542 ; NDUFS8-006; exon 1

  ENST00000532399 ; NDUFS8-003; exon 3

  ENST00000525419 ; NDUFS8-013; intron 3

  ENST00000525419 ; NDUFS8-013; intron 3

  ENST00000532399 ; NDUFS8-003; exon 3

  ENST00000532399 ; NDUFS8-003; exon 3

  ENST00000525419 ; NDUFS8-013; intron 3

  ENST00000529645 ; NDUFS8-009; intron 4

  ENST00000529645 ; NDUFS8-009; intron 4

  ENST00000529645 ; NDUFS8-009; intron 4

  ENST00000313468 ; NDUFS8-001; intron 5

  ENST00000526446 ; NDUFS8-008; intron 5

  ENST00000526339 ; NDUFS8-015; intron 5

  ENST00000526339 ; NDUFS8-015; intron 5

  ENST00000313468 ; NDUFS8-001; intron 5

  ENST00000526446 ; NDUFS8-008; intron 5

  ENST00000313468 ; NDUFS8-001; intron 5

  ENST00000526446 ; NDUFS8-008; intron 5

  ENST00000526339 ; NDUFS8-015; intron 5

Database links

• ENTREZGENE: 100616403;MIR4691

Mature sequence hsa-miR-4691-5p

• Accession: MIMAT0019781
• Sequence: 14 - guccuccaggccaugagcugcgg - 36
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4691-5p
  • MIRDB:hsa-miR-4691-5p
  • TARGETMINER:hsa-miR-4691-5p

Mature sequence hsa-miR-4691-3p

• Accession: MIMAT0019782
• Sequence: 53 - ccagccacggacugagagugcau - 75
• Deep sequencing: 23 reads, 7 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4691-3p
  • MIRDB:hsa-miR-4691-3p
  • TARGETMINER:hsa-miR-4691-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).