Stem-loop sequence hsa-mir-4690

Accession MI0017323
Description Homo sapiens miR-4690 stem-loop
Stem-loop 
-g  c    -ga          a  -  gug 
  ag aggc   ggcugggcug ac cc   g
  || ||||   |||||||||| || ||    
  uc uccg   ucgacccgac ug gg   g
cg  -    gag          g  a  agu
Get sequence
Deep sequencing
5 reads, 5 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 65403781-65403840 [+]
sense
OTTHUMT00000390324 ; PCNXL3-003; intron 13
OTTHUMT00000390324 ; PCNXL3-003; intron 13
OTTHUMT00000390324 ; PCNXL3-003; intron 13
OTTHUMT00000390321 ; PCNXL3-001; intron 33
OTTHUMT00000390321 ; PCNXL3-001; intron 33
OTTHUMT00000390321 ; PCNXL3-001; intron 33
ENST00000439247 ; PCNXL3-003; intron 13
ENST00000439247 ; PCNXL3-003; intron 13
ENST00000439247 ; PCNXL3-003; intron 13
ENST00000355703 ; PCNXL3-001; intron 33
ENST00000355703 ; PCNXL3-001; intron 33
ENST00000355703 ; PCNXL3-001; intron 33
Database links

Mature sequence hsa-miR-4690-5p

Accession MIMAT0019779
Sequence

1 -  

gagcaggcgaggcugggcugaa

 - 22

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4690-3p

Accession MIMAT0019780
Sequence

39 -  

gcagcccagcugaggccucug

 - 59

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).