Stem-loop sequence hsa-mir-4688

Accession

MI0017321

Description

Homo sapiens miR-4688 stem-loop

Stem-loop

     cu      gug  aag    uucg   u    c   a     
gucua  cccagg   cc   cugu    ugu cccu ccu gggg 
|||||  ||||||   ||   ||||    ||| |||| ||| ||| a
caggu  gggucc   gg   gacg    acg ggga gga cccu 
     cc      --a  --a    ----   -    u   -     

Deep sequencing

18 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 46397952-46398034 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000390013 ; DGKZ-021; intron 5

  OTTHUMT00000390013 ; DGKZ-021; intron 5

  OTTHUMT00000390013 ; DGKZ-021; intron 5

  OTTHUMT00000389771 ; DGKZ-003; intron 20

  OTTHUMT00000390003 ; DGKZ-009; intron 20

  OTTHUMT00000389771 ; DGKZ-003; intron 20

  OTTHUMT00000390003 ; DGKZ-009; intron 20

  OTTHUMT00000389771 ; DGKZ-003; intron 20

  OTTHUMT00000390003 ; DGKZ-009; intron 20

  OTTHUMT00000389995 ; DGKZ-004; intron 22

  OTTHUMT00000389995 ; DGKZ-004; intron 22

  OTTHUMT00000389995 ; DGKZ-004; intron 22

  OTTHUMT00000389770 ; DGKZ-001; intron 23

  OTTHUMT00000389997 ; DGKZ-007; intron 23

  OTTHUMT00000389998 ; DGKZ-005; intron 23

  OTTHUMT00000389999 ; DGKZ-008; intron 23

  OTTHUMT00000398328 ; DGKZ-022; intron 23

  OTTHUMT00000398329 ; DGKZ-023; intron 23

  OTTHUMT00000389770 ; DGKZ-001; intron 23

  OTTHUMT00000389997 ; DGKZ-007; intron 23

  OTTHUMT00000389998 ; DGKZ-005; intron 23

  OTTHUMT00000389999 ; DGKZ-008; intron 23

  OTTHUMT00000398328 ; DGKZ-022; intron 23

  OTTHUMT00000398329 ; DGKZ-023; intron 23

  OTTHUMT00000389770 ; DGKZ-001; intron 23

  OTTHUMT00000389997 ; DGKZ-007; intron 23

  OTTHUMT00000389998 ; DGKZ-005; intron 23

  OTTHUMT00000389999 ; DGKZ-008; intron 23

  OTTHUMT00000398328 ; DGKZ-022; intron 23

  OTTHUMT00000398329 ; DGKZ-023; intron 23

  OTTHUMT00000389772 ; DGKZ-002; intron 24

  OTTHUMT00000389772 ; DGKZ-002; intron 24

  OTTHUMT00000389772 ; DGKZ-002; intron 24

  ENST00000543978 ; DGKZ-203; intron 3

  ENST00000543978 ; DGKZ-203; intron 3

  ENST00000543978 ; DGKZ-203; intron 3

  ENST00000529698 ; DGKZ-021; intron 5

  ENST00000529698 ; DGKZ-021; intron 5

  ENST00000529698 ; DGKZ-021; intron 5

  ENST00000528615 ; DGKZ-003; intron 20

  ENST00000528173 ; DGKZ-009; intron 20

  ENST00000528615 ; DGKZ-003; intron 20

  ENST00000528173 ; DGKZ-009; intron 20

  ENST00000528615 ; DGKZ-003; intron 20

  ENST00000528173 ; DGKZ-009; intron 20

  ENST00000531879 ; DGKZ-004; intron 22

  ENST00000318201 ; DGKZ-201; intron 22

  ENST00000531879 ; DGKZ-004; intron 22

  ENST00000318201 ; DGKZ-201; intron 22

  ENST00000531879 ; DGKZ-004; intron 22

  ENST00000318201 ; DGKZ-201; intron 22

  ENST00000343674 ; DGKZ-001; intron 23

  ENST00000524984 ; DGKZ-007; intron 23

  ENST00000532868 ; DGKZ-005; intron 23

  ENST00000527911 ; DGKZ-008; intron 23

  ENST00000456247 ; DGKZ-022; intron 23

  ENST00000421244 ; DGKZ-023; intron 23

  ENST00000395574 ; DGKZ-202; intron 23

  ENST00000343674 ; DGKZ-001; intron 23

  ENST00000524984 ; DGKZ-007; intron 23

  ENST00000532868 ; DGKZ-005; intron 23

  ENST00000527911 ; DGKZ-008; intron 23

  ENST00000456247 ; DGKZ-022; intron 23

  ENST00000421244 ; DGKZ-023; intron 23

  ENST00000395574 ; DGKZ-202; intron 23

  ENST00000343674 ; DGKZ-001; intron 23

  ENST00000524984 ; DGKZ-007; intron 23

  ENST00000532868 ; DGKZ-005; intron 23

  ENST00000527911 ; DGKZ-008; intron 23

  ENST00000456247 ; DGKZ-022; intron 23

  ENST00000421244 ; DGKZ-023; intron 23

  ENST00000395574 ; DGKZ-202; intron 23

  ENST00000454345 ; DGKZ-002; intron 24

  ENST00000454345 ; DGKZ-002; intron 24

  ENST00000454345 ; DGKZ-002; intron 24

Database links

• ENTREZGENE: 100616368;MIR4688

Mature sequence hsa-miR-4688

• Accession: MIMAT0019777
• Sequence: 55 - uaggggcagcagaggaccuggg - 76
• Deep sequencing: 18 reads, 5 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4688
  • MIRDB:hsa-miR-4688
  • TARGETMINER:hsa-miR-4688

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).