Stem-loop sequence hsa-mir-4687

Accession MI0017319
Description Homo sapiens miR-4687 stem-loop
Stem-loop 
     ag     a    u     c   c     cu g  g 
accug  gagcc gccc ccucc gca ccaaa  u ga c
|||||  ||||| |||| ||||| ||| |||||  | ||  
ugggc  cucgg cggg ggagg ugu gguuu  a uu a
     -g     a    -     u   c     cc g  c
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 3877292-3877371 [+]
sense
OTTHUMT00000383059 ; STIM1-004; intron 1
OTTHUMT00000257196 ; STIM1-001; 3'UTR (exon 1)
OTTHUMT00000383059 ; STIM1-004; intron 1
OTTHUMT00000257196 ; STIM1-001; 3'UTR (exon 1)
OTTHUMT00000383059 ; STIM1-004; intron 1
OTTHUMT00000257196 ; STIM1-001; 3'UTR (exon 1)
ENST00000525403 ; STIM1-004; intron 1
ENST00000300737 ; STIM1-001; 3'UTR (exon 1)
ENST00000525403 ; STIM1-004; intron 1
ENST00000300737 ; STIM1-001; 3'UTR (exon 1)
ENST00000525403 ; STIM1-004; intron 1
ENST00000300737 ; STIM1-001; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-4687-5p

Accession MIMAT0019774
Sequence

12 -  

cagcccuccucccgcacccaaa

 - 33

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4687-3p

Accession MIMAT0019775
Sequence

52 -  

uggcuguuggagggggcaggc

 - 72

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).