|
miRBase |
|
Stem-loop sequence hsa-mir-4685 |
|||||
| Accession | MI0017317 | ||||
| Description | Homo sapiens miR-4685 stem-loop | ||||
| Stem-loop |
- c uu gu ca uu gu uagcc agggc gga gggg agg guug g ||||| ||||| ||| |||| ||| |||| aucgg ucccg ccu uccc ucc cggu a g - -u -- uc uu au |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4685-5p |
|
| Accession | MIMAT0019771 |
| Sequence |
4 - cccagggcuuggaguggggcaagguu - 29 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4685-3p |
|
| Accession | MIMAT0019772 |
| Sequence |
48 - ucucccuuccugcccuggcuag - 69 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|