Stem-loop sequence hsa-mir-4684

Accession

MI0017316

Description

Homo sapiens miR-4684 stem-loop

Stem-loop

             c                      auuu 
gcaccagggguac ucucuacugacuugcaacauac    g
||||||||||||| ||||||||||||||||||||||     
cgugguucccaug agagguggcugaacguugugug    u
             c                      guuc 

Genome context

• Coordinates (GRCh37.p5): chr1: 23046010-23046091 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000008059 ; EPHB2-003; intron 1

  OTTHUMT00000008060 ; EPHB2-001; intron 1

  OTTHUMT00000008061 ; EPHB2-002; intron 1

  OTTHUMT00000008059 ; EPHB2-003; intron 1

  OTTHUMT00000008060 ; EPHB2-001; intron 1

  OTTHUMT00000008061 ; EPHB2-002; intron 1

  OTTHUMT00000008059 ; EPHB2-003; intron 1

  OTTHUMT00000008060 ; EPHB2-001; intron 1

  OTTHUMT00000008061 ; EPHB2-002; intron 1

  ENST00000374630 ; EPHB2-003; intron 1

  ENST00000400191 ; EPHB2-001; intron 1

  ENST00000374632 ; EPHB2-002; intron 1

  ENST00000544305 ; EPHB2-202; intron 1

  ENST00000374630 ; EPHB2-003; intron 1

  ENST00000400191 ; EPHB2-001; intron 1

  ENST00000374632 ; EPHB2-002; intron 1

  ENST00000544305 ; EPHB2-202; intron 1

  ENST00000374630 ; EPHB2-003; intron 1

  ENST00000400191 ; EPHB2-001; intron 1

  ENST00000374632 ; EPHB2-002; intron 1

  ENST00000544305 ; EPHB2-201; intron 1

  ENST00000374625 ; EPHB2-201; intron 2

  ENST00000374625 ; EPHB2-201; intron 2

Database links

• ENTREZGENE: 100616391;MIR4684

Mature sequence hsa-miR-4684-5p

• Accession: MIMAT0019769
• Sequence: 14 - cucucuacugacuugcaacaua - 35
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4684-5p
  • MIRDB:hsa-miR-4684-5p
  • TARGETMINER:hsa-miR-4684-5p

Mature sequence hsa-miR-4684-3p

• Accession: MIMAT0019770
• Sequence: 50 - uguugcaagucgguggagacgu - 71
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4684-3p
  • MIRDB:hsa-miR-4684-3p
  • TARGETMINER:hsa-miR-4684-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).