|
miRBase |
|
Stem-loop sequence hsa-mir-4683 |
|||||
| Accession | MI0017315 | ||||
| Description | Homo sapiens miR-4683 stem-loop | ||||
| Stem-loop |
gac gca - a - gg g uc ac aga cg ggcgggc cugga u caccagu u || ||| || ||||||| ||||| | ||||||| g ug ucu gc ccgcucg gaccu a guggucg g -cu aac a - u ag g cc |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4683 |
|
| Accession | MIMAT0019768 |
| Sequence |
50 - uggagauccagugcucgcccgau - 72 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|