Stem-loop sequence hsa-mir-4681

Accession MI0017313
Description Homo sapiens miR-4681 stem-loop
Stem-loop 
   ----a     aa     g         cag   a 
ggc     acggg  ugcag cuguaucug   ggc u
|||     |||||  ||||| |||||||||   ||| u
ccg     ugucc  acguc gacguggac   ucg g
   gacac     ag     g         -aa   u
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 121137484-121137555 [+]
sense
OTTHUMT00000050652 ; GRK5-002; intron 2
OTTHUMT00000050652 ; GRK5-002; intron 2
OTTHUMT00000050652 ; GRK5-002; intron 2
ENST00000392870 ; GRK5-002; intron 2
ENST00000457057 ; GRK5-202; intron 2
ENST00000392870 ; GRK5-002; intron 2
ENST00000457057 ; GRK5-202; intron 2
ENST00000392870 ; GRK5-002; intron 2
Database links

Mature sequence hsa-miR-4681

Accession MIMAT0019766
Sequence

4 -  

aacgggaaugcaggcuguaucu

 - 25

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).