Stem-loop sequence hsa-mir-4679-2

AccessionMI0017311 (change log)
Symbol HGNC:MIR4679-2
DescriptionHomo sapiens miR-4679-2 stem-loop
Gene family MIPF0001228; mir-4679
Stem-loop
   ua                              uu   u 
5'   ucuuuuuucugugauagagauucuuugcuu  ugu u
     ||||||||||||||||||||||||||||||  ||| c
3'   agaaaaaagacacuaucucuaagaaacgaa  aca u
   gc                              --   a 
Get sequence
Deep sequencing
138 reads, 4.35 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 89063335-89063411 [-]
sense
OTTHUMT00000049199 ; RP11-322M19.1-001; intron 1
OTTHUMT00000049203 ; RP11-322M19.1-005; intron 1
OTTHUMT00000049201 ; RP11-322M19.1-003; intron 2
OTTHUMT00000049202 ; RP11-322M19.1-004; intron 3
OTTHUMT00000049209 ; RP11-322M19.1-011; intron 3
OTTHUMT00000049206 ; RP11-322M19.1-008; intron 3
OTTHUMT00000049210 ; RP11-322M19.1-012; intron 3
OTTHUMT00000049204 ; RP11-322M19.1-006; intron 3
ENST00000456104 ; NUTM2A-AS1-001; intron 1
ENST00000420424 ; NUTM2A-AS1-005; intron 1
ENST00000433530 ; NUTM2A-AS1-003; intron 2
ENST00000451940 ; NUTM2A-AS1-004; intron 3
ENST00000447424 ; NUTM2A-AS1-011; intron 3
ENST00000433920 ; NUTM2A-AS1-008; intron 3
ENST00000446751 ; NUTM2A-AS1-012; intron 3
ENST00000413722 ; NUTM2A-AS1-006; intron 3
Clustered miRNAs
< 10kb from hsa-mir-4679-2
hsa-mir-4679-1chr10: 89063336-89063410 [+]
hsa-mir-4679-2chr10: 89063335-89063411 [-]
Database links

Mature sequence hsa-miR-4679

Accession MIMAT0019763
Sequence

10 - 

ucugugauagagauucuuugcu

 - 31

Get sequence
Deep sequencing236 reads, 63 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).